biology case study examples

Status message

Using case studies with large classes.

Why Use Case Studies?

Case studies are powerful tools for teaching. They explore the story behind scientific research to understand the phenomenon being studied, the question the scientist asked, the thinking they used to investigate it, and the data they collected to help students better understand the process and content of science.

A strength of this approach is that it gives students the chance to consider how they would investigate a topic. Their answers are often similar to what the researchers being studied did. But students also come up with novel perspectives and unique approaches to the problems.

Many BioInteractive resources lend themselves to a case study approach. In most instances, what I ultimately decide is to convert the resource into a case study. For example, the video Animated Life: Mary Leakey is an excellent tool to get students thinking about the logic scientists use to study fossils and extinct species. Data Point resources are also a rich source of figures and questions that can be copied and pasted into a presentation to provide a brief case study that introduces a topic.

The Challenge for Large Classes

Many BioInteractive activities are structured in a way that they are particularly useful for smaller groups and classes. And by smaller, I am thinking of fewer than 50 students. To some colleagues, that may seem to be a large class size. Indeed, in many instances, it probably is more than is optimal.

However, when I refer to large classes, what I am thinking of are the large introductory classes encountered in many colleges and universities in which enrollment can range from 100 to 500 or more depending on the institution. Classes of this size present instructors with the dual challenges of not just numbers but also anonymity. It’s logistically unmanageable to share and distribute printed copies of handouts or worksheets.

How to Scale Up

So how can an instructor promote the interaction that is essential to the success of these types of case study activities in such a large group? These are issues I grappled with when I went from teaching at a small liberal arts college where my classes were smaller than 30 to teaching at a large university with classes of several hundreds. I have found what I think are four parts to an effective solution.

1. Define a learning objective.

First and foremost, whether I have 30 or 300 students, I try to think about why I want to use a particular BioInteractive resource. I consider what it is that I want the students to do or think about while using the resource. How do I want them to be different after completing the assignment? In essence, I define the learning objective so I can determine the most effective platform and approach to deliver the lesson utilized in the resource.

2. Create presentations with strategic pause points.

PowerPoint is a common tool for delivering material in large classrooms. It is quite easy to take images and questions from BioInteractive resource PDFs and insert them into slides. After reading the teaching notes and text in the student handouts, it’s relatively simple to develop the story that weaves the slides together in an interrupted case study. This is a style of case study that progressively leads students through the information with carefully planned “reveals” of information and strategically placed questions as stopping points to ponder the material along the way.

Videos are also fabulous resources to use during interrupted case studies in class. For example, I regularly use the video Niche Partitioning and Species Coexistence , which describes Dr. Rob Pringle’s work on niche partitioning in the savanna, as the core of a video case study in class. After the class watches the video for a few minutes, I stop and ask students about the phenomenon being studied and approaches that could be used to answer different questions.

I often use the following questions/prompts:

• Why would anyone care about factors shaping species presence or absence?
• Think about what factors could be important influences on shaping species richness in a community.

How can we use modern techniques to study what an animal is eating when we can’t watch the animal eat? The video does an excellent job of addressing these topics and showing how researchers developed a creative approach to applying molecular techniques to answer ecological questions. How awesome is it that one video can help students tie together the central dogma, ecological theory, and community concepts! Depending on how much an instructor wants to structure the video case study in advance, it is even possible to embed small video clips and questions directly into a PowerPoint presentation.

3. Have students use clickers.

How should we tell the scientific story to large numbers of students and engage them in it? Clickers are a particularly helpful tool for asking questions about experiments, concepts, or results, because they present students with a specific moment when they need to choose among different options for a survey of their opinion or decide among right and wrong answers in a multiple-choice question.

For example, I typically start a case study with survey questions asking students to identify what they think is the most important item on a list of potential phenomena or to give their feedback about an issue in a Likert-scale response. Later, as the case study develops, I ask more specific questions about the experiment that require students to predict experimental outcomes or interpret a figure. For example, when I use the video The Effects of Fungicides on Bumble Bee Colonies , I show students several bar graphs with possible outcomes for the experiment and have them pick which they think the researchers will observe. After revealing the actual results, I ask them questions about interpreting the results and whether the results support the experimental hypothesis. I always allow students to talk and help one another during clicker questions to enhance their interaction and give them a choice to go along with a group opinion or answer based on their individual thinking.

4. Flip the classroom.

Another effective way to use BioInteractive resources in large classes is to use videos to flip a class session. BioInteractive animations and short films are rich with information that can pique interest, start discussions, or provide fundamental information. For example, I recently had my students watch the Genes as Medicine short film outside of class time. I asked them to then imagine they were an alien that found this video clip and to consider what information it would give them about life on Earth. This sparked a lively discussion about what life is to start the next class meeting that was more interesting than me going through a checklist of terms and definitions. Students had to uncover the characteristics of life from the video for themselves.

Benefits and Takeaways

What I hope these hints and suggestions from my own experiences show is how relatively simple it can be to scale up these resources to engage a class of any size. When they first encounter case studies, students can be a little unsure about this approach that requires them to talk to one another in a setting where they are expecting to be a face in the crowd. However, after they experience one or two case studies, I can see groups of students talking and exchanging ideas about the case. They are no longer passive listeners sitting in a room but instead have become active problem solvers seeking answers together. I can leave the stage and mingle through the room to listen to their discussions and encourage them as they develop their answers. This also gives me an opportunity to interact with students besides those sitting in the front row and to further develop a sense of community and connection, solving one of the challenges with big classes: anonymity.

It has been my experience that students quickly adapt to and begin to enjoy this approach. Rather than sitting in class watching yet another series of PowerPoint slides flash by, they are thinking and talking about science with one another. After my students talk things through with their neighbors and “shoulder buddies” during a case study, I find that they are more likely to speak up in class during the case study and at other points during the course.

At the beginning of the semester, I can barely get anyone to answer a question. After a few case studies, students begin asking and answering questions (even when we aren’t doing case studies), and the level of participation by different students in the room is noticeably higher. So in addition to case studies being a more interesting way for me as the teacher to present material to students and explore different biological topics, this approach also has the added benefits of helping build confidence within individual students and community among students, which makes a more rewarding and exciting learning environment for everyone.

Educational case studies based on examples of simulated or real research data can engage students in the process of thinking like a scientist, even when it is not possible to get into the field or laboratory to actually run an experiment. They can help overcome the challenges of data analysis and interpretation that are at the core of science education experiences. The collections of different resources available through HHMI BioInteractive provide a menu of modules for instructors to choose from that do just that. They get students to explore important biological topics from a variety of different approaches and look at the world through the lenses of different scientists. Regardless of what the actual format of a resource is when I encounter it, I know that it is possible to scale it up in some way to meet the needs of my classes.

Come join a  conversation  about this blog post at our Facebook group!

Phil Gibson is a professor at the University of Oklahoma, where he enjoys teaching his students that learning a little botany never hurt anyone and is probably good for them in the long run. When he’s not thinking about new resources to use in class, he enjoys hiking with his family, listening to music, and cooking outrageously large breakfasts on the weekends.

Related Articles

Cindy Gay presents BioInteractive's short video clip demonstrating the fruit fly courtship dance and its role in selection. She describes how she uses the clip in her AP® Biology curriculum, and how it connects to topics ranging from animal behavior to sympatric speciation.

Kim Parfitt describes two activities (now merged into the activity “Scientific Inquiry and Data Analysis Using WildCam Gorongosa”) associated with the WildCam Gorongosa project. She also discusses a short film on lion populations in Gorongosa that she uses to introduce the topic.

In this video Educator Voices post, hear from St. John Fisher College professor Kaitlin Bonner about how she uses a publicly available data set, along with BioInteractive’s elephant resources, to have her students investigate data.

• school Campus Bookshelves
• menu_book Bookshelves
• perm_media Learning Objects
• login Login
• how_to_reg Request Instructor Account
• hub Instructor Commons
• Download Page (PDF)
• Download Full Book (PDF)
• Periodic Table
• Physics Constants
• Scientific Calculator
• Reference & Cite
• Tools expand_more
• Readability

selected template will load here

This action is not available.

Case Study: Unusual microbes

• Last updated
• Save as PDF
• Page ID 404

Terminology

Epulopiscium, thiomargarita, small bacteria.

• Bacteria that give birth to live young

Square bacteria

Microbes with too much dna, microbes with too many genes, bacteria with "atypical" chromosomes.

• Bacteria that can count -- and talk

Bacteria that know where north is

Bacteria that eat other bacteria, multicellular bacteria, a huge virus, the biggest microbe, briefly noted, contributors, introduction.

This page was written in collaboration with Borislav Dopudja, a third-year science student at the University of Zagreb. It grew out of some casual but extensive discussions we were having exploring some of the oddities of the microbial world, things that don't quite fit with our common views. It seems worthwhile to share some of these. There is no attempt here to be profound, but rather to have some fun enjoying the diversity of the microbial world. Borislav's web site is: www.pluff-sky.net/. I have also listed it, with more information, on my page of Internet resources: Biology Miscellaneous in the Biology: other section.

What are "microbes"? Microbes (or microorganisms) are small organisms. For our purposes, that means single-celled organisms. The single cells may be prokaryotic or eukaryotic. The prokaryotic microbes include the bacteria and the archaea (or the eubacteria and archaebacteria, by older terminology). The eukaryotic microbes include the protists (protozoa), the fungi and at least the unicellular algae. The terms are not always used consistently, especially in older literature. Whether viruses should be included is a matter of taste, and I won't be entirely consistent there; for the most part, we will discuss cellular organisms.

Most of the links below are to web sites that are suitable for "the general audience". A few links to articles from the regular scientific literature are given in small type. In particular, in some cases I have included links to the first reports of these organisms or of key features.

Many links are to Microbe magazine -- or to its precursor, ASM News. Microbe is the news magazine of the American Society for Microbiology. Microbe is written for microbiologists, but written to be enjoyed by a wide range of non-specialists. Both the news stories and feature articles can serve well as readable material with serious scientific content, yet not too technical. Microbe is now freely available online. Links to individual items are given as they come up. If you would like to browse Microbe magazine -- recommended! -- go to http://www.microbemagazine.org/ . The current issue will come up; for more, see "Explore Microbe" at the left.

Some links are given to original articles or news stories in Science magazine. Some of these are freely available online, though you may need to create a free registration before getting access to the full text. In general, Science releases research articles -- but not news stories -- for free access 12 months after publication; their file goes back to about 1997. (Those with institutional subscription access, such as those using university computers at UC Berkeley, have full access, and will not be asked to register or log on.) The home page for Science magazine: http://www.sciencemag.org .

Big bacteria

One of the most characteristic properties of bacteria is that they are small. Microscopic. Barely visible under the microscope: we can tell their general shape, but can generally see very little structure. Typical dimensions are on the order of 1 micrometer (1 μm). So, have a look at Epulopiscium and Thiomargarita -- bacteria big enough to be seen with the naked eye. These bacteria -- at least the larger specimens -- approach 1 millimeter (1 mm) in size. One of these was first reported in 1985 -- but not understood to be a bacterium until 1993; the other was first reported in 1999.

Epulopiscium grows in the gut of certain fish. It has a complex life cycle, which is coordinated with the daily rhythm of its host. This complex -- and unusual -- life cycle qualifies Epulopiscium for another section of this page: Bacteria that give birth to live young .

• http://microbewiki.kenyon.edu/index.php/Epulopiscium . From the Microbe Wiki.
• www.microbelibrary.org/index....ium-fishelsoni. From the Microbe Library at ASM.
• www.accessexcellence.org/LC/ST/st12bg.php. "Epulopiscium fishelsoni, Big bug baffles biologists!", an essay on this unusual bug, from Peggy E Pollak & W Linn Montgomery, both early investigators of Epulos. (Another Access Excellence page is listed on this page, in the section The biggest microbe? . The Access Excellence site is listed as a general resource on my page of Miscellaneous Internet Resources, under Of local interest... -- since it had its origins near here.)

Cornell researchers study bacterium big enough to see -- the Shaquille O'Neal of bacteria . Press release (May 6, 2008) on new work showing that an Epulopiscium cell contains 100,000 or so copies of its genome, thus has many times more DNA than a human cell. This site is worth it for the pictures alone. The upper picture is a classic, showing an Epulo, a paramecium and an ordinary E. coli bacterium. http://www.news.cornell.edu/stories/...cteria.kr.html . The paper, from Angert's lab at Cornell and collaborators in Australia and New Zealand, is: J E Mendell et al, Extreme polyploidy in a large bacterium. PNAS 105:6730-6734, 5/6/08. Online: http://www.pnas.org/content/105/18/6730.abstract .

The first report of Epulopiscium, describing it as a large and peculiar cigar-shaped organism, presumably a protist: L Fishelson et al, A unique symbiosis in the gut of tropical herbivorous surgeonfish (Acanthuridae: Teleostei) from the Red Sea. Science 229:49, 7/5/85. The abstract is freely available at http://www.sciencemag.org/content/22...08/49.abstract . You may or may not be able to get the full article at that site. If not and you have an institutional subscription to JStor, such as at UCB, try www.jstor.org/stable/1695432. The definitive report that Epulopiscium is really a bacterium: E R Angert et al, The largest bacterium. Nature 362:239, 3/18/93. http://www.nature.com/nature/journal.../362239a0.html .

Thiomargarita can be quite big, but it "cheats". It is mostly vacuole. Why? Well, it is quite like a deep sea diver carrying an oxygen tank. Thiomargarita uses nitrate ions in its respiration, rather than oxygen gas; the vacuole is a supply of nitrate that lets the bug continue to respire at great depths.

Is Life Thriving Deep Beneath the Seafloor? An article from the Woods Hole Oceanographic Institute (WHOI). http://www.whoi.edu/oceanus/viewArticle.do?id=2497 . To focus on Thiomargarita, scroll down to "The world's largest bacterium". The article is by WHOI oceanographer Carl Wirsen, April 2004. WHOI microbiologist Andreas Teske was part of the team that discovered Thiomargarita; he is a co-author of the Science paper listed below as the original report.

The original report on Thiomargarita: H N Schulz et al, Dense populations of a giant sulfur bacterium in Namibian shelf sediments. Science 284:493, 4/16/99. It is accompanied by a news story: B Wuethrich, Microbiology: Giant sulfur-eating microbe found. Science 284:415, 4/16/99. The article is freely available at: http://www.sciencemag.org/content/28...3/493.abstract .

Scientists from UC Berkeley, led by Dr Jill Banfield, have found an archaeon smaller than any cellular organism previously known. It is about 200 nm (0.2 μm) diameter. It is so small that it is very near the "limit" of what people think might be the smallest possible organism. In fact, some people think it might be below that limit! Time will tell whether the new claim is valid. An important issue is whether this is a "complete" organism, or a parasite of some kind that is absolutely dependent on other cells to provide basic functions. This is part of their work on the acidic mine drainage from the Richmond Mine at Iron Mountain, Calif.

Shotgun sequencing finds nanoorganisms. A news release from UC Berkeley, December 2006, on this discovery: http://www.berkeley.edu/news/media/releases/2006/12/21_microbes.shtml . The original report on this tiny organism: B J Baker et al, Lineages of acidophilic archaea revealed by community genomic analysis. Science 314:1933, 12/22/06. http://www.sciencemag.org/content/31.../1933.abstract .

There is another story of small bacteria, a story that has been around for several years but has not really been confirmed. The basic idea is a claim that there are tiny bacteria involved in such processes as calcification of your arteries. These bacteria, which have been termed nanobacteria , are alleged to be even smaller than those discussed above -- far below any reasonable limit of what is "possible" for a living cell. Since these alleged organisms really do not fit in any modern understanding of what cells are, solid evidence is needed -- and is lacking. Two new papers appeared in early 2008 with rather strong evidence that these "things" are not alive. They appear to be some calcium minerals, complexed with protein. They may well be interesting, and they may still be involved in disease processes, but they are not bacteria. The Wikipedia entry is a good introduction to these "nanobacteria" (or "calcifying nanoparticles"), including the uncertainties that surround them. It notes these 2008 papers, and has links to them, and to one good news story on the new findings. http://en.Wikipedia.org/wiki/Nanobacterium .

Bacteria divide by binary fission: they grow bigger, and then divide in two. But there are exceptions. An interesting type of exception occurs when bacteria seem to give birth to live young. That is, they develop new cells inside, and then liberate these daughter cells. One of the first cases where this type of bacterial reproduction was seen was with Epulopiscium, discussed in the section on Big bacteria . Then it was found in the bacterium Metabacterium -- but in a form that was easier to understand. It has long been known that some bacteria make spores. Specifically, bacteria of the genera Bacillus and Clostridia make "endospores": each cell makes one spore, a resistant structure that is capable of long term survival. Such spore formation does not increase the population, because each cell makes one spore. It merely results in a new type of cell, the resistant spore. But Metabacterium makes multiple spores per cell -- and rarely undergoes the more "ordinary" process of binary fission. Thus a variation of ordinary endospore formation has become the primary means of reproduction. With Epulopiscium, it would seem that this process has been modified further, so that what is produced is not spores but rather ordinary cells -- baby cells.

Thus both Metabacterium and Epulopiscium "give birth to live young" -- a process that can be thought of as a variation of ordinary endospore formation.

Esther Angert, Beyond binary fission: Some bacteria reproduce by alternative means. Microbe 1:127, 3/06: forms.asm.org/microbe/index.asp?bid=41230 (HTML) or forms.asm.org/ASM/files/ccLib...0306000127.pdf (PDF). Angert, at Cornell, works with both Metabacterium and Epulopiscium. She was the first to recognize that Epulopiscium was actually a bacterium.

Metabacterium with four daughter spores . The figure at the right shows a single Metabacterium polyspora cell containing four spores, with the bright appearance that is typical of bacterial endospores. The individual spores are several μm long. The figure is a trimmed version of a figure at: author.cals.cornell.edu/cals/...abacterium.cfm. That page discusses the life cycle of Metabacterium, and how it relates to the natural environment for this organism. It is part of Esther Angert's web site; the home page is author.cals.cornell.edu/cals/...-lab/intro.cfm.

More links for Epulopiscium are in the section on Big bacteria .

What is the shape of bacteria? Round. Or roundish -- such as rods with rounded ends. Certainly not square, with sharp corners. Imagine then the surprise of the scientist who, in 1980, found square bacteria with sharp corners, in concentrated salt solutions. They are not only square, but very thin -- about 200 nm (0.2 μm) thick. They seem to grow as two dimensional objects, increasing the size of their squares, but not their thickness. Square bacteria caught in the act of division look like a sheet of postage stamps.

Their thinness increases their surface to volume ratio; this may be important in helping them to maintain a proper intracellular environment. They probably spend much energy pumping ions out!

It is not known why they are square or how they achieve their squareness. The square bacteria are archaea. (That was recognized in the original report; at that time, the archaebacteria were considered a type of bacteria, whereas we now consider them a distinct group from the bacteria per se.) They have been named Haloquadratum walsbyi.

The following two links both include good pictures of the square bacteria. The figure at the right is a variation of one shown at the second site, Dyall-Smith's web site.

• Square bacteria grown in the laboratory. Press release, from the University of Melbourne, announcing the first successful growth of the square bacteria in the lab, October 2004. uninews.unimelb.edu.au/news/1855/.
• Web site for Dr Mike Dyall-Smith, group leader for that work: http://www.haloarchaea.com/ . The broad topic of the site is Haloarchaea and Haloviruses.

Edwin Abbott would have loved them. http://www.ibiblio.org/eldritch/eaa/FL.HTM . A good read!

Genome paper: H Bolhuis et al, The genome of the square archaeon Haloquadratum walsbyi: life at the limits of water activity. BMC Genomics 7:169, 7/4/06. Free online: http://www.biomedcentral.com/1471-2164/7/169 . The original report of these organisms: A E Walsby, A square bacterium. Nature 283:69, 1/3/80. It's a delightful little paper, a brief report of a quite unexpected observation. Online: http://www.nature.com/nature/journal.../283069a0.html . Even reading the opening lines, which are freely available there, gives a nice hint of the literary quality of this paper. However, it probably requires subscription for full access.

The organism with the largest known genome? Amoeba dubia, a protist. 670 billion base pairs of DNA. That is about 200 times more than we have. What is the significance of this finding? It's not at all clear. In fact, it is hard to even find the source of the number. Is this really a measure of the haploid genome size? Or is it simply based on the cellular DNA content, with the assumption that the cell is diploid? Not only is the original source hard to pin down, there seems to be no modern work following it up. But the number is oft-quoted, so we quote it too. Someday we may understand what it means.

For a nice discussion of genome sizes, see http://www.genomesize.com/statistics.php . Scroll down to the section "A comment on the overall animal range", and what follows, including a nice graph summarizing genome sizes over all types of organisms. This is from T Ryan Gregory, Univ Guelph. Regardless of the ultimate verdict on the Amoeba dubia genome, many organisms have genomes much larger than ours.

In the web page referred to above, Gregory gives genome size in picograms (pg). Biologists often give genome sizes in base pairs (bp). 1 picogram of DNA is about 10 9 (one billion) base pairs. For example, the human genome contains about 3.5 billion bp, and weighs about 3.5 pg. Gregory's genome size site is also referred to on my Internet resources - Molecular Biology page, under Genomes , and in the Musings post Who is #1: the most DNA? (March 7, 2011) .

The human genome project brought us the revelation that we have only about 22,000 genes -- not all that many more than a worm (Caenorhabditis elegans, 20,000 genes) or a fruit fly (Drosophila melanogaster, 14,000 genes). Now, Trichomonas vaginalis - a common sexually-transmitted protist (protozoan)... Its genome sequence was reported in January 2007. Preliminary analysis suggests about 60,000 genes.

Don't make too much of this. Gene counts are notoriously difficult, as we learned from the human genome project. Identification of genes simply by looking at DNA sequences is something of an art. In fact, the report offers multiple numbers for the gene count, using different criteria. Of course, I chose the higher one for this note. Further, the significance of the gene count is unclear. We now understand that many proteins can be made from a "single" gene (for example, by alternative splicing). Nevertheless, this stands, at least for now: the most genes known in any microbe, in fact, in any organism. Glossary entry: Alternative splicing .

News story in Microbe, 4/07: "Peculiar" T. vaginalis parasites are jam-packed with genes. forms.asm.org/microbe/index.asp?bid=49481.

Scientists Crack the Genome of the Parasite Causing Trichomoniasis. The press release from the New York Univ School of Medicine, one of the lead institutions for this work. January 11, 2007. http://communications.med.nyu.edu/ne...trichomoniasis .

The report of the Trichomonas genome: J M Carlton et al, Draft genome sequence of the sexually transmitted pathogen Trichomonas vaginalis. Science 315:207, 1/12/07. Online: http://www.sciencemag.org/content/315/5809/207.short .

In the early days, it was very difficult to observe bacterial chromosomes. Bacteria are small, and their chromosomes are quite tiny by comparison with eukaryotic chromosomes. Further, bacterial chromosomes do not condense into more compact and more easily visible bodies, again in contrast to eukaryotic chromosomes. So, information about bacterial chromosomes emerged slowly, with various -- and mostly indirect -- techniques.

The early work suggested that bacteria have only one chromosome, and that it is circular. In one case, one E coli chromosome was even observed -- a circle. Other work seemed consistent with this, so the generality emerged: bacteria have only one chromosome, and it is circular. Both of these features served to distinguish bacteria from the eukaryotes. And that was nice: bacteria are supposedly "simpler", and having only one chromosome is certainly "simpler". Further, having a circular chromosome avoided the difficulties of replicating linear DNA, and could also be considered "simpler".

Alas, it is not really so. Neither feature is universal among bacteria. This web site discusses bacterial chromosomes, and has a table showing the number and type of chromosomes found in many bacteria. http://www.sci.sdsu.edu/~smaloy/MicrobialGenetics/topics/chroms-genes-prots/chromosomes.html . From Stanley Maloy, San Diego State University. It is part of a larger site on the broader topic of microbial genetics: http://www.sci.sdsu.edu/~smaloy/MicrobialGenetics/ .

The following site is from a discussion of bacterial genetics in an online microbiology textbook. I include it here particularly because it contains a nice copy of a very famous figure, which I referred to above. Go to http://www.ncbi.nlm.nih.gov/books/NBK7908/ ; scroll down to Fig 5.2. This shows a single chromosome of one E coli cell, in the act of replicating. It is clearly circular.

That site is from Chapter 5, Genetics, by R K Holmes & M G Jobling, of the online book Medical Microbiology, 4th edition, edited by S Baron. This online book is listed in the Microbiology: books section of my page of Internet resources: Biology - Miscellaneous. The figure is from John Cairns, Cold Spring Harbor Symposia on Quantitative Biology 28:44, 1963.

Some bacteria can emit light -- more or less as fireflies do. The phenomenon is called bioluminescence. But the light from a single bacterial cell would be too dim to be of any use. So, isolated bacteria do not emit light. They only emit light when there are many of them together, so that -- together -- they give off a substantial amount of light. Clearly, bacteria can count how many neighbors they have.

How do bacteria count their population size? The basic logic of how they do it is actually rather simple. To make light, they need an "inducer" -- a substance that turns on the light-producing system. They make an inducer, and secrete it into the external environment. They then take it up from the environment. What does this accomplish? Well, imagine a simple situation of bacteria growing in a test tube. If there are only a few bacteria, there will be little inducer in the tube. When the bacteria try to take up inducer from the environment, they find very little -- and thus they do not emit light. But if the bacteria grow, so that there are many many bacteria in the tube, all making and secreting inducer, then the bacteria find a high level of inducer in the environment; they take it up, and emit light. Thus the bacteria sense their population size by responding to the level of inducer in the medium; as a result, they emit light only when the population size is large.

Is that artificial situation of a test tube of bacteria relevant to the bacteria in nature? Indeed it is. Some fish cultivate these bacteria in a special pouch, called a light organ. The light organ emits light only when it contains enough bacteria to do so usefully.

The phenomenon discussed above is often called quorum sensing . That is, the bacteria check to see if a quorum is present before emitting light. The details of this are now quite well understood. And as the system was being studied, it became clear that it was simply one example of a much wider phenomenon: bacteria communicating to each other, for a range of purposes. In this case, the bacteria are communicating their population size to their own kind. But more broadly, bacteria are signaling their presence -- and numbers -- to other types of bacteria too.

What is the highest temperature at which life is possible? We all know that many of the molecules in living systems are quite sensitive to heat; the ease of cooking an egg reminds us of that regularly.

When I was in college, the highest temperature reported for life was around 60° C (degrees Celsius), the maximum temperature (T max ) for growth of the bacterium Bacillus stearothermophilus. Since then, the known maximum has increased to at least 113° C, and perhaps even to 121° C. This increase came along with the discoveries of an entirely new class of microorganism, the archaea, and of a new geological phenomenon, the deep sea thermal vent; both discoveries date from 1977. Thus the increase in known T max for life is not simply an abstract story of some biological limit, but is part of a broad series of major advances in both biology and geology.

Thermus aquaticus has a maximum growth temperature of about 80° C. It was isolated from hot springs in Yellowstone National Park, and was reported in 1969. Thermus aquaticus is perhaps the organism that ushered in the new era of the commercialization of enzymes from thermopiles -- useful precisely because of their heat stability; the "Taq" DNA polymerase made the polymerase chain reaction -- PCR -- practical.

As noted above, 1977 brought the separate discoveries of archaea and deep sea thermal vents. Over the following years, these stories converged, and a succession of hyperthermophilic archaea were discovered near the vents. 1997 brought Pyrolobus fumarii, which grows up to 113° C; this archaeon has been widely accepted as having the highest known T max . 2003 brought a report of an archaeon that could grow at 121° C -- the normal operating temperature of an autoclave commonly used to kill even the most resistant forms of life, or so we thought. This organism has been dubbed simply Strain 121 for now.

These continuing discoveries of organisms with ever higher T max , maybe even up to the common operating temperature of an autoclave, raise some questions: ... [ more ]

Derek Lovley's web page (Univ Massachusetts) on the work that led to Strain 121: www.geobacter.org/Life-Extreme.

The first report of Strain 121. K Kashefi & D R Lovley, Extending the upper temperature limit for life. Science 301:934, 8/15/03. Online at http://www.sciencemag.org/content/301/5635/934.full . For more about Lovley's lab, see "Electricigenic bacteria" in either the Redox section of the page for Internet resources for Intro Chem or the Carbohydrates section of the page for Internet resources for Intro Organic/Biochem. For an update, see a summary of the Ninth International Conference on Thermophiles (Bergen, Norway, September 2007). T Satyanarayana, Meeting report: Thermophiles 2007. Current Science 93(10):1340, 11/25/07. Current Science, published by the Indian Academy of Sciences is freely available online. This article is at: http://www.ias.ac.in/currsci/nov252007/1340.pdf . The article contains a number of interesting tidbits. They suggest that the finding that strain S121 grows at 121° C has been questioned; they also suggest that another microbe has been shown to grow at 122° C at high pressure. It is normal enough that such claims are questioned. Time will tell. None of these details change the general perspective on high temperature microbes presented here.

A microbiologist looks at a sample under the microscope. He notices that the bacteria seem to be moving over to one side of the microscope slide. Why? Perhaps they are responding to the light. So he adjusts the lighting, and it has no effect. After numerous such observations and tests, the conclusion is inescapable: the bacteria go north. Now, that is novel! He looks at the bacteria further, and finds that they contain tiny magnets -- iron oxide magnets, just like simple toy magnets. And that is how magnetic bacteria were discovered -- by Richard Blakemore in 1975.

Why do these bacteria use a magnet to guide their swimming? A common idea -- not entirely accepted -- is that these bacteria benefit from following the earth's magnetic lines of force. Doing that leads them "down" into the mud, which seems good for their lifestyle. Consistent with this, it was soon found that -- for some types of magnetic bacteria -- those in the northern hemisphere swim north, whereas those in the southern hemisphere swim south.

Magnetic Microbes , by Sandi Clement. commtechlab.msu.edu/Sites/dlc.../caOc96SC.html.

Magnetosomes . The figure at the right is from Richard Frankel's page: Magnetotactic Bacteria Photo Gallery. www.calpoly.edu/~rfrankel/mtbphoto.html. The figure shows a single cell of the bacterium Magnetospirillum magnetotacticum, with a chain of magnetosomes. Each individual magnetosome in the chain is approximately 45 nm across, and surrounded by a membrane. The Gallery page listed has many more figures, showing the diversity of magnetic bacteria. And for more, go to Frankel's home page, at Cal Poly San Luis Obispo: www.calpoly.edu/~rfrankel/. Scroll down to Research Interests, then Magnetotactic Bacteria.

R B Frankel & D A Bazylinski, Magnetosome mysteries. ASM News 70:176, 4/04. The news magazine ASM News -- now called Microbe -- is free online; this item is at forms.asm.org/microbe/index.asp?bid=26445.

C N Keim et al, Magnetoglobus, Magnetic aggregates in anaerobic environments. Microbe 2:437, 9/07. Microbe, the news magazine of the American Society for Microbiology is free online; this item is at forms.asm.org/microbe/index.asp?bid=52638. An article about a type of magnetic bacterium that normally occurs in multicellular aggregates. Should this be considered a multicellular bacterial organism? Considering that question gives insight into what multicellularity is about. This article is also listed in the section Multicellular bacteria .

W Hansen, This End Up -- Magnetic organelles point bacteria in the right direction. Berkeley Science Review, Issue 14, Spring 2008, p 8. A brief introduction to work on magnetic bacteria being done by Arash Komeili at UCB. Berkeley Science Review (BSR), published by UCB graduate students, is free online; this item is at sciencereview.berkeley.edu/ar...ticle=briefs_1.

The first report of magnetic bacteria: R Blakemore, Magnetotactic bacteria. Science 190:377-379, 10/24/75. The abstract is freely available at http://www.sciencemag.org/content/190/4212/377.abstract . You may or may not be able to get the full article at that site. If not and you have an institutional subscription to JStor, such as at UCB, try Access to Blakemore article through JStor.

The story of predatory bacteria starts with Bdellovibrio , a type of bacterium that obligatory lives within other bacterial cells. Since they kill the bacteria that they infect, Bdellovibrios form clear regions on a lawn of dense bacterial growth, much like bacterial viruses form plaques. But they are not viruses. They are cellular, with rather ordinary bacterial cells. It's just that they grow in a way that we find unusual. Well, it's not the "way" that is unusual as much as it is the "where". They burrow into a bacterial cell, and grow there.

E Jurkevitch, Predatory behaviors in bacteria -- diversity and transitions. Microbe 2:67, 2/07. Microbe, the news magazine of the American Society for Microbiology, is free online; this item is at forms.asm.org/microbe/index.asp?bid=48203.

At the end of the article listed above, Jurkevitch raises an interesting speculation about the possible role of predatory bacteria in the origin of the eukaryotic cell. Biologists agree that the mitochondrion arose from a bacterium that got inside another cell. But how did it get there? Bacteria do not show phagocytosis -- do not engulf other cells. However, predatory bacteria such as Bdellovibrio offer an alternative. Perhaps mitochondria originated by a predation event that led to symbiosis. There is no evidence on this point, so it must be regarded as speculation for now. At least it is a plausible view of how one of the great events of biological history might have occurred.

Single cells. Grow, and then divide into two. That is our simple image of bacteria. However, as we learn more about this vast group of organisms, we find that bacteria can be more complex. The myxobacteria probably have the most complex bacterial life cycle. They spend part of their life as free-living individual bacterial cells, then aggregate to form a fruiting body, an organized multicellular structure visible to the naked eye. In fact, their life cycle is rather similar to that of the cellular slime molds, such as Dictyostelium -- the myxomycetes.

Myxobacteria web page : http://myxobacteria.ahc.umn.edu/ . In particular, step through the section What are the Myxobacteria? for a good introduction with some wonderful pictures. From Dr Martin Dworkin, with the help of Tim Leonard, at the University of Minnesota.

M Dworkin, Lingering Puzzles about Myxobacteria . Microbe 2:18, 1/07. Dworkin's "puzzles" include:

• How the cells construct the multicellular, macroscopic fruiting body
• The biochemical basis of myxospore morphogenesis
• The mechanism and function of individual cellular motility
• The regulation of directionality of social movement
• The mechanism of the cells' ability to perceive physical objects at a distance
• The role of the myxobacteria in nature.

Microbe, the news magazine of the American Society for Microbiology, is free online; this item is at forms.asm.org/microbe/index.asp?bid=47794 (HTML) or forms.asm.org/ASM/files/ccLib...0107000018.pdf (PDF).

C N Keim et al, Magnetoglobus, Magnetic aggregates in anaerobic environments. Microbe 2:437, 9/07. Microbe, the news magazine of the American Society for Microbiology is free online; this item is at forms.asm.org/microbe/index.asp?bid=52638. An article about a type of magnetic bacterium that normally occurs in multicellular aggregates. Should this be considered a multicellular bacterial organism? Considering that question gives insight into what multicellularity is about. This article is also listed in the section Bacteria that know where north is . Other topics on this page introduce other ways in which some bacteria are more complex that we might have thought. These include:

Ordinary organisms are based on cells. The organisms reproduce by the cells growing and dividing. Viruses are different. Viruses are small and simple. Viruses do not grow and divide. They reproduce by infecting a cell, disassembling, and then directing the production of new "parts", which then assemble into new virus particles.

Small and simple? Well, usually. The smallest viruses have one millionth or so the amount of genome (DNA or RNA) we do. Some have only a handful of genes. Some have only a piece of DNA (or RNA) and a simple protein coat -- no machinery for making anything, and no enzymes.

Some viruses are not so small and not so simple. Biologists have still been able to make a clear distinction between viruses and cells, primarily by looking at their basic strategy for reproduction. Cells grow and divide; viruses disassemble and reassemble.

The most recent challenge to the simplicity of viruses is the mimivirus , which grows in the protozoan Acanthamoeba polyphaga. It has about three times more genetic material (DNA) than any previously known virus -- more DNA than some bacteria. It is bigger than some bacteria -- about 400 nm (0.4 μm) diameter. And it is quite complex, with a collection of enzymes that are supposedly not to be found in viruses. For example, mimivirus codes for several enzymes used in protein synthesis -- genes never before found in any virus. Yet its life style (and structure) make it clear that this is a virus. It was characterized as a virus only in 2003.

2008 brings new developments that make the story of mimivirus even more fascinating. First, a new mimivirus, even bigger than the first. They call it mamavirus. But perhaps more importantly, a satellite virus: a virus that can grow only in cells infected by mimivirus. A news story about this satellite virus, dubbed Sputnik: 'Sputnik' Virus Orbits, Hijacks Other Viruses, Aug. 13, 2008. dsc.discovery.com/news/2008/0...s-sputnik.html.

Discussions about mimivirus and Sputnik inevitably seem to wander onto topics such as "What is a virus?" or even "What is life?" These are fun to discuss, but a caution: they need not have simple answers, or even any answers at all beyond our common definitions. Use such questions to provide a framework for your knowledge and understanding, but forcing simple answers to complex questions is not fruitful. Mimivirus has its own website: http://www.giantvirus.org .

The organism now known as mimvirus was found in 1992. The first paper that identified it as a virus: B La Scola et al, A giant virus in Amoebae. Science 299:2033, 3/28/03. Online: http://www.sciencemag.org/content/299/5615/2033.short . The report of the Sputnik satellite virus: B La Scola et al, The virophage as a unique parasite of the giant mimivirus. Nature 455:100, 9/4/08. There is a good news story about this finding: Biggest known virus yields first-ever virophage. Microbe 3:505, 11/08. Free online: microbemagazine.org/images/st...1108000502.pdf. Scroll down to the story, on page 4 of the file.

Probably the unicellular green alga Acetabularia , whose cells can be several centimeters long. Because of the large size, Acetabularia was a favorite organism for studying the relationship between nucleus and cytoplasm. The following links introduce the organism and some classic experimental work.

• en.Wikipedia.org/wiki/Acetabularia. Basic introduction to Acetabularia.
• www.accessexcellence.org/RC/V...mmerling_s.php. Classic work on the role of nucleus and cytoplasm in determining cell development, done by J Hammerling in the 1930s. The large cells of Acetabularia allowed a simple but novel transplantation to be done; the results revealed the key role of the nucleus. This item is given as a link at the end of the previous one. (Another Access Excellence page is listed on this page, in the section Big bacteria . The Access Excellence site is listed as a general resource on my page of Miscellaneous Internet Resources, under Of local interest... -- since it had its origins near here.)

This section is something of a "miscellany" -- a place to briefly note some other unusual aspects of microbial life. In some cases, I may make only a single small point or note only a single paper, Perhaps some of these will grow into "full-blown" topics at some point, or perhaps we will just keep a section of "miscellany".

G forces? Humans don't do well with g forces a few times normal gravity. Microbes do better, it seems. A recent paper shows that several microbes studied, bacteria and yeast, grew in an ultracentrifuge tube with accelerations many thousands of times g. Two of the bacterial grew at the highest accelerations tested, over 400,000 x g. They have no information about what limits the growth as the g force increases; they speculate that it has something to do with sedimentation within the cell. That organisms vary might allow them to pursue finding what is important. It is also unclear why this is of interest. After all, such high g forces are found in nature only under extreme conditions, such as the shock waves of supernovae. For now, this paper is basically just a cute finding. It will be interesting to see where it leads.

• News story... Bacteria Grow Under 400,000 Times Earth's Gravity (National Geographic, April 25, 2011): http://news.nationalgeographic.com/news/2011/04/110425-gravity-extreme-bacteria-e-coli-alien-life-space-science/ .
• The paper... S Deguchi et al, Microbial growth at hyperaccelerations up to 403,627 x g. PNAS 108:7997, May 10, 2011. Online at: http://www.pnas.org/content/108/19/7997 .

Where is the inside? Some bacteria, such as the gram negatives, have a double membrane system. It is the inner membrane that is energized, and used to make ATP. Now we have a discovery of the first double membrane system of an archaeon -- and it is the outer membrane that is energized. The archaeon, Ignicoccus hospitalis , is closely associated with Nanoarchaeum equitans -- which relies on the Ignicoccus for its energy; is this energy parasitism dependent on the unusual energy system of the Ignicoccus? The authors even wonder whether Ignicoccus might be an ancestor of the eukaryotic cell. Clearly, this is an unusual and intriguing finding -- still quite incomplete.

For a fine introduction to this novel system, see the ASM blog entry by Moselio Schaechter... Of Archaeal Periplasm & Iconoclasm (February 11, 2010): http://schaechter.asmblog.org/schaechter/2010/02/of-archaeal-periplasm-iconoclasm.html .

The paper... U Küper et al, Energized outer membrane and spatial separation of metabolic processes in the hyperthermophilic Archaeon Ignicoccus hospitalis . PNAS 107:3152, 2/16/10. Online at: http://www.pnas.org/content/107/7/3152 .

Arsenic . There are bacteria that can oxidize arsenic compounds, and there are bacteria that can reduce arsenic compounds. Now there is a report of bacteria that can use arsenite -- AsO 3 3- , containing As(III) -- as the electron donor for photosynthesis. (The most common electron donor is water -- with oxygen gas being evolved. The most common electron donor in anaerobic systems is sulfide, often with sulfur granules being produced.) Analysis of this process suggests that arsenic metabolism is quite ancient, and that it is an important part of the arsenic cycle in nature. News story: In Lake, Photosynthesis Relies on Arsenic, August 18, 2008. http://www.nytimes.com/2008/08/19/science/19obarsenic.html .

The paper... T R Kulp et al, Arsenic(III) Fuels Anoxygenic Photosynthesis in Hot Spring Biofilms from Mono Lake, California. Science 321:967, 8/15/08. Online at: http://www.sciencemag.org/content/321/5891/967.abstract .

Microbes survive the cold . Scientists have recovered DNA and even viable bacteria from ancient ice samples in the Antarctic (and other places). The idea is that bacteria were trapped in the ice, perhaps in pockets of liquid water just big enough for the one cell. The bacteria may have carried out maintenance reactions, perhaps only a few chemical reactions per day, to survive. Even with quibbling about how old each sample really is, this is still a fascinating insight into survival of life in extreme conditions. News story: Eight-million-year-old bug is alive and growing, August 7, 2007. http://www.newscientist.com/article/dn12433 .

Here are a couple of papers, both of which should be freely available. The first goes with the news story listed above, and is generally about the isolation of the old bacteria and their DNA. The second, from UC Berkeley, is about how the bacteria may metabolize and survive in the ice. K D Bidle et al, Fossil genes and microbes in the oldest ice on Earth. PNAS 104:13455, 8/14/07. Free online at: http://www.pnas.org/content/104/33/13455.abstract . R A Rohde & P B Price, Diffusion-controlled metabolism for long-term survival of single isolated microorganisms trapped within ice crystals. PNAS 104:16592, 10/16/07. Free online at: http://www.pnas.org/content/104/42/16592.abstract .

A lonely bug . Organisms live in complex communities. Seems pretty basic in our modern understanding of biology. Certainly, we expect to find bacteria in complex communities. So, it is striking when we find a report of the discovery of a bacterial growth in a South African goldmine that seems to contain only one species. Of course, it is hard to exclude some very low level of other organisms, but the analysis shows that the main bacterium, called Candidatus Desulforudis audaxviator, is at least 99.9% of the culture.

What is it growing on down there? Well, seems likely that it is using the energy from uranium decay as its main energy source. So this loner is also a nuclear-powered bug.

The paper is: D. Chivian et al, Environmental Genomics Reveals a Single-Species Ecosystem Deep Within Earth . Science 322:275, 10/10/08. Free online at: http://www.sciencemag.org/content/322/5899/275.abstract . For a good news story about this work, see Journey Toward The Center Of The Earth: One-of-a-kind Microorganism Lives All Alone , 10/10/08: http://http://www.sciencedaily.com/releases/2008/10/081009143708.htm .

More "Curious microbes"

While looking for some nice web sites to include in the various sections above, I came across Sandi Clement's page on Magnetic Microbes listed for Bacteria that know where north is . Turns out that is part of a larger site with a theme rather similar to this one -- and written by students in a class on Extreme and Unusual Microbes taught by Dr. Rick Martin at the Center for Microbial Ecology, Michigan State Univ. The site is called The Curious Microbe - Essays of the Extreme and the Unusual : commtechlab.msu.edu/Sites/dlc...us/cindex.html.

• Robert Bruner ( http://bbruner.org )

This page  viewed 12064  times The BioWiki has 46066 Modules.

The Biology Corner

Biology Teaching Resources

Blood Case Studies for Anatomy (Hematology)

I found this assignment online and re-created it to work for remote-learning, so that it is now in slide format. This format will also work when students are back to in-person learning. I plant to print the slides in color and then place them into dry-erase sleeves so that students can write on them with expo markers and then erase for the next class. This saves on color printing costs and paper.

Another thing that is preferable with in-person learning is the ability for students to work together and communicate what they know. Each group can get a single case (slide) and then we can share the images on the projector. They can point out to the class where the data is highlighted to indicate an abnormal values.

If using this as a remote assignment, I don’t think it would be too much to ask students to complete all of the slides. (Note: if you assign this on LMS, you will need to make a copy and remove the note on the slide that has the answer.)

Ideally, students will have already learned about various conditions, like sickle cell disease and anemia. I have Google slides and guided notes for these units. The remote version, Interactive Slides: Blood also explains the different types of blood cells and their functions.

Each slide shows a CBC (complete blood count) with values for each type of blood cell in the sample. The normal range is shown next to the patient values, so students can easily compare the two. The image of the blood slide does not reveal as many clues as the CBC panel, and is mainly there as a reference.

There are five cases, each showing a particular condition with the CBC counts. Students highlight any abnormalities in the patient’s blood. For example, Teddy has swollen lymph nodes and a high lymphocyte count. From the list of possibilities, the best fit for his disorder is mononucleosis. Each slide has the answer listed under speaker notes. If you are assigning the slides over LMS, make a copy that does not include the answers.

Related posts:

Shannan Muskopf

We use cookies to enhance our website for you. Proceed if you agree to this policy or learn more about it.

• Essay Database >
• Essays Samples >
• Essay Types >
• Case Study Example

Biology Case Studies Samples For Students

29 samples of this type

Over the course of studying in college, you will inevitably need to compose a bunch of Case Studies on Biology. Lucky you if linking words together and turning them into relevant content comes easy to you; if it's not the case, you can save the day by finding an already written Biology Case Study example and using it as a model to follow.

This is when you will definitely find WowEssays' free samples catalog extremely useful as it contains numerous skillfully written works on most various Biology Case Studies topics. Ideally, you should be able to find a piece that meets your requirements and use it as a template to compose your own Case Study. Alternatively, our competent essay writers can deliver you a unique Biology Case Study model crafted from scratch according to your personal instructions.

Computer Security/ Biometrics Tech, User Authentication, Biological Identity And Case Study Examples

Finding the correct balance between security, cost effectiveness and ease of use presents a major headache for the Metropolitan Police Service (MPS). This is because maintaining a large workforce and clerical staff for the purposes of managing database and internal systems can be a costly practice. MPS staff also require different log in details for the different accounts they hold in different job roles. This paper examines different approaches such as Enterprise Identity Mapping (EIM), Public Key Infrastructure (PKI) and RSA encryption and how they may be utilized in the MPS context.

Borderline Personality Disorder Case Study Sample

Chemical, biological, radiological, and nuclear (cbrn agents) case study samples.

Don't waste your time searching for a sample.

Get your case study done by professional writers!

Just from $10/page

Biology Of Disease Case Studies Examples

Biology of disease, sample case study on the problems of boys dont cry from queer and feminist perspectives, good casey: a major depressive disorder case study example, relevant demographic information case studies example, issues in psychology: hypothetical case study in two-stage life development, free case study on the gender binary in boys dont cry, example of case study on genetics question: is there any family history of mental illness, preliminary investigation case study examples, investigating a crime scene, child protection-child abuse, neglect, and case planning case study example, northern university.

Respectfully Submitted to: Type Month and Year

Free Talent Identification Case Study Example

Introduction, evaluation of scientific knowledge regarding the conservation of the kokako species case study example, good example of project title case study.

H.R. 1412, the Justice and Integrity Act of 2009

H.R. 1412, the Justice and Integrity Act of 2009 A Report from Rep. Steve Cohen (d-tenn.), Discussing Racial Disparities in the Criminal Justice System That He Can Use To Move This Bill Forward in Congress

Free Case Study On Bayer AG: Anthrax And Cipro

Discussion of the case, free case study on mental health, mental health.

Introduction One of the main branches of psychology is mental assessment. This part of psychology calls for numerous observations and ability to relate a certain behavior or response to a set of responses to comprehensively understand the mental status of a person (http://yalepress.yale.edu/yupbooks/excerpts/hicks_50.pdf).

It usually involves careful observation of any possible or visible cue that might give a clue to the mental status a person, a lot of careful questioning and taking of notes as well as mental history of the person under observation. It also calls for human behavior understanding and causes of the various types of mental ailments (http://yalepress.yale.edu/yupbooks/excerpts/hicks_50.pdf).

Assessment procedure

Expertly crafted case study on adaptations of animals that plants lack., discussion board 5, alcoholism a complex disorder: free sample case study to follow.

(Insert Institution)

Alcoholism a Complex Disorder

Free juvenile delinquency case study sample, free case study on the aging process, good example of case study on alternative work schedule, drug and alcohol addiction case studies example, sample case study on system architecture of a compound light microscope, rule case study example, business law case study - case no. 112,063.

Issues 1.Was the appellee entitled to a reimbursement of the maintenance costs he had paid to the children welfare? 2.Did the trial court have the authority to modify an administrative order?

Oklahoma Laws provides that a trial court has the authority to amend an order that it has made if new fats that warrant its amendment are discovered during the hearing of the case.

Application

Jeffrey dahmer case study samples.

The topic of the paper is murder, and its mission is to discuss the crimes of Jeffrey Dahmer and relating this crime with the three categories of crime causation. Murder is the deliberate taking of another person life. Murder can be first-degree and second-degree murder where in the first degree both the intention and the killing is planned (Brown et al, 2010). This paper will also discuss how Jeffery Dahmer killed people deliberately out of ill will.

Good Example Of Osteoporosis Case Study

Case study on john bio psychosocial profile 4, psychology: case study.

Introduction 3

Initial interview 4 Assessment formulation methods utilized 4 Assessment of John presenting problems and goals 5 Analysis and critique of MMT approach 6 Agreed goals 6 Treatment plan 6 CBT interventions 7 Intervention for cognitions-thoughts records 7 Benefits of the approach 7 Interventions for behavior- activity scheduling/diversion techniques 8 Benefits of the approach/ interaction 8 Interventions for imagery/interpersonal- imagery based exposure 8 Benefit of approach 9 Intervention for sensation- relaxation/ visualization 10 Conclusion 11

APPENDIX 1 13

The key issues case study sample.

There are many issues surrounding the life of Marci, the 23 year old young woman that seems to be losing her mind because of perceived indulgence into drugs. Among the primary issues surrounding the life of Marci, the young woman, are such things as:

List in order of importance

Dora's case study example.

Password recovery email has been sent to [email protected]

Use your new password to log in

You are not register!

By clicking Register, you agree to our Terms of Service and that you have read our Privacy Policy .

Now you can download documents directly to your device!

Check your email! An email with your password has already been sent to you! Now you can download documents directly to your device.

or Use the QR code to Save this Paper to Your Phone

The sample is NOT original!

Short on a deadline?

Don't waste time. Get help with 11% off using code - GETWOWED

No, thanks! I'm fine with missing my deadline

North-East Research Conclave

NERC 2022: Trends in Teaching-Learning Technologies pp 97–111 Cite as

Importance of Biology for Engineers: A Case Study

• Chinmaya Panda   ORCID: orcid.org/0000-0002-9575-6913 5 ,
• R. Shreya 5 &
• Lalit M. Pandey 5  
• Conference paper
• First Online: 29 August 2023

83 Accesses

The field of biological sciences has grown multitude in the past decade to address real-life challenges and industrial innovations to cater to the needs of society. Different biological phenomena can be approximated in terms of physical processes of mechanical work, electrical signals, and chemical energy. Considering the immense importance that biology and life-sciences hold for humankind, simplification of complex biological phenomena is a must for imparting greater understanding to multidisciplinary researchers. Therefore, many Universities have diversified their undergraduate bioscience program to include interdisciplinary courses focusing on biomechanics, bioinformatics, nanobiotechnology, and many more. Together with the study aspect, research is also being conducted in the diverse research areas of biotechnology. Keeping sustainability and co-existence in mind, students and engineers should be trained to initiate better innovations and contribute their ideas for protecting the ecosystem around them.

• Biological sciences
• Bioengineering
• Biotechnology

This is a preview of subscription content, log in via an institution .

Buying options

• Available as PDF
• Read on any device
• Instant download
• Own it forever
• Available as EPUB and PDF
• Durable hardcover edition
• Dispatched in 3 to 5 business days
• Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Breithaupt, H. (2006). The engineers approach to biology. EMBO Reports, 7 (1), 21–23. https://doi.org/10.1038/sj.embor.7400607

Brent, R. (2004). A partnership between biology and engineering. Nature Biotechnology, 22 , 1211–1214. https://doi.org/10.1038/nbt1004-1211

Article   Google Scholar  

Schuster, B., Junkin, M., Kashaf, S. S., Romero-Calvo, I., Kirby, K., Matthews, J., Tay, S., et al. (2020). Automated microfluidic platform for dynamic and combinatorial drug screening of tumor organoids. Nature Communications, 11 (1), 1–12. https://doi.org/10.1038/s41467-020-19058-4

Quesada-González, D., & Merkoçi, A. (2018). Nanomaterial-based devices for point-of-care diagnostic applications. Chemical Society Reviews, 47 (13), 4697–4709. https://doi.org/10.1039/C7CS00837F

Li, W., Pei, Y., Zhang, C., & Kottapalli, A. G. P. (2021). Bioinspired designs and biomimetic applications of triboelectric nanogenerators. Nano Energy, 84 , 105865. https://doi.org/10.1016/j.nanoen.2021.105865

Tsiapalis, D., De Pieri, A., Biggs, M., Pandit, A., & Zeugolis, D. I. (2017). Biomimetic bioactive biomaterials: The next generation of implantable devices. ACS Biomaterials Science and Engineering, 3 (7), 1172–1174. https://doi.org/10.1021/acsbiomaterials.7b00372

Cho, I. H., Kim, D. H., & Park, S. (2020). Electrochemical biosensors: Perspective on functional nanomaterials for on-site analysis. Biomaterials Research, 24 (1), 1–12. https://doi.org/10.1186/s40824-019-0181-y

Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., Hassabis, D., et al. (2021). Highly accurate protein structure prediction with AlphaFold. Nature, 596 (7873), 583–589. https://doi.org/10.1038/s41586-021-03819-2

Raman, R., Mitchell, M., Perez-Pinera, P., Bashir, R., & DeStefano, L. (2016). Design and integration of a problem-based biofabrication course into an undergraduate biomedical engineering curriculum. Journal of Biological Engineering, 10 (1), 1–8. https://doi.org/10.1186/s13036-016-0032-5

French, K. E. (2019). Harnessing synthetic biology for sustainable development. Nature Sustainability, 2 (4), 250–252. https://doi.org/10.1038/s41893-019-0270-x

Download references

Author information

Authors and affiliations.

Department of Biosciences and Bioengineering, Indian Institute of Technology, Guwahati, Assam, India

Chinmaya Panda, R. Shreya & Lalit M. Pandey

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Lalit M. Pandey .

Editor information

Editors and affiliations.

Department of Civil Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam, India

Hemant B. Kaushik

Department of Mechanical Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam, India

Uday Shanker Dixit

Department of Computer Science and Engineering, Indian Institute of Technology Guwahati, Guwahati, Assam, India

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, India

Bithiah Grace Jaganathan

Rights and permissions

Reprints and permissions

Copyright information

© 2023 The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd.

About this paper

Cite this paper.

Panda, C., Shreya, R., Pandey, L.M. (2023). Importance of Biology for Engineers: A Case Study. In: Kaushik, H.B., Dixit, U.S., Jose, J., Jaganathan, B.G. (eds) Trends in Teaching-Learning Technologies. NERC 2022. Springer, Singapore. https://doi.org/10.1007/978-981-99-4874-1_8

Download citation

DOI : https://doi.org/10.1007/978-981-99-4874-1_8

Published : 29 August 2023

Publisher Name : Springer, Singapore

Print ISBN : 978-981-99-4873-4

Online ISBN : 978-981-99-4874-1

eBook Packages : Education Education (R0)

Share this paper

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Publish with us

Policies and ethics

• Find a journal
• Track your research

• Free Samples
• Premium Essays
• Editing Services Editing Proofreading Rewriting
• Extra Tools Essay Topic Generator Thesis Generator Citation Generator GPA Calculator Study Guides Donate Paper
• Essay Writing Help
• About Us About Us Testimonials FAQ
• Biology Case Study
• Samples List

An case study examples on biology is a prosaic composition of a small volume and free composition, expressing individual impressions and thoughts on a specific occasion or issue and obviously not claiming a definitive or exhaustive interpretation of the subject.

Some signs of biology case study:

• the presence of a specific topic or question. A work devoted to the analysis of a wide range of problems in biology, by definition, cannot be performed in the genre of biology case study topic.
• The case study expresses individual impressions and thoughts on a specific occasion or issue, in this case, on biology and does not knowingly pretend to a definitive or exhaustive interpretation of the subject.
• As a rule, an essay suggests a new, subjectively colored word about something, such a work may have a philosophical, historical, biographical, journalistic, literary, critical, popular scientific or purely fiction character.
• in the content of an case study samples on biology , first of all, the author’s personality is assessed - his worldview, thoughts and feelings.

The goal of an case study in biology is to develop such skills as independent creative thinking and writing out your own thoughts.

Writing an case study is extremely useful, because it allows the author to learn to clearly and correctly formulate thoughts, structure information, use basic concepts, highlight causal relationships, illustrate experience with relevant examples, and substantiate his conclusions.

• Studentshare

Examples List on Biology Case Study

• TERMS & CONDITIONS
• PRIVACY POLICY
• COOKIES POLICY

myCBSEguide

• Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

• What is the objective of this action?
• Explain how the gene of interest is introduced into a vector.
• You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
• A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

• progesterone
• luteinizing hormone
• follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

• Peak of Hormone B will be observed at a higher point in the graph
• Peak of Hormone B will be observed at a point lower than what is given in the graph
• There will be no observed data for Hormone B
• The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

• Corpus Luteum
• Tertiary follicle
• Graafian follicle
• Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

• Subject 1 is pregnant
• Subject 2 is pregnant
• Both subject 1 and 2 are pregnant
• Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

• Penicillium notatum
• Saccharomyces cerevisiae
• Aspergillus niger
• Clostridium butylicum
• thermal vents
• polluted water
• all of these
• None of the above
• production of a large amount of CO 2
• production of O 2
• due to the presence of water
• none of these
• Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
• Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
• Our Assertion is true but the Reason is false
• Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Related Posts

• Competency Based Learning in CBSE Schools
• Class 11 Physical Education Case Study Questions
• Class 11 Sociology Case Study Questions
• Class 12 Applied Mathematics Case Study Questions
• Class 11 Applied Mathematics Case Study Questions
• Class 11 Mathematics Case Study Questions
• Class 11 Biology Case Study Questions
• Class 12 Physical Education Case Study Questions

Leave a Comment

Save my name, email, and website in this browser for the next time I comment.

• Publications
• Conferences & Events
• Professional Learning
• Science Standards
• Awards & Competitions
• Daily Do Lesson Plans
• Free Resources
• American Rescue Plan
• For Preservice Teachers
• NCCSTS Case Collection
• Partner Jobs in Education
• Interactive eBooks+
• Digital Catalog
• Regional Product Representatives
• e-Newsletters
• Bestselling Books
• Latest Books
• Popular Book Series
• Prospective Authors
• Web Seminars
• Exhibits & Sponsorship
• Conference Reviewers
• National Conference • Denver 24
• Leaders Institute 2024
• National Conference • New Orleans 24
• Submit a Proposal
• Latest Resources
• Professional Learning Units & Courses
• For Districts
• Online Course Providers
• Schools & Districts
• College Professors & Students
• The Standards
• Teachers and Admin
• eCYBERMISSION
• Toshiba/NSTA ExploraVision
• Junior Science & Humanities Symposium
• Teaching Awards
• Climate Change
• Earth & Space Science
• New Science Teachers
• Early Childhood
• Middle School
• High School
• Postsecondary
• Informal Education
• Journal Articles
• Lesson Plans
• e-newsletters
• Science & Children
• Science Scope
• The Science Teacher
• Journal of College Sci. Teaching
• Connected Science Learning
• NSTA Reports
• Next-Gen Navigator
• Science Update
• Teacher Tip Tuesday
• Trans. Sci. Learning

MyNSTA Community

• My Collections

Classic Experiments in Molecular Biology

By Robin Pals-Rylaarsdam

Share Start a Discussion

All introductory biology textbooks, and many sophomore-level genetics textbooks as well, describe several classic experiments in molecular biology. This interrupted case study takes students through two of these classic experiments, namely, those by Griffith and Avery, McCarty and MacLeod that showed DNA to be the genetic material in Streptococcus pneumoniae , and the experiment by Meselson and Stahl that demonstrated DNA replication to be semiconservative. Engaging students with the experiments in a more exploratory manner can reinforce the nature of scientific discovery and the logic behind these findings. The case, which has been formatted as two separate exercises that can be used independently, was developed for use in introductory biology classes for biology majors. The material is accessible enough to also be useful for non-majors college biology or high school AP biology students.

Download Case

Date Posted

• Accurately describe the experiments performed by each group, observations made, and conclusions drawn.
• Articulate several possible outcomes/hypotheses for a given experiment, select the outcome that best fits the data collected, and explain why the other hypotheses are rejected in light of the data.
• Accurately answer questions regarding the evidence for semiconservative replication and the evidence for DNA being the genetic material in E. coli.

DNA; Griffith; Avery; Streptococcus pneumonia; genetic material; DNA replication; Meselson; Stahl; semi-conservative; experimental data; experimental design

Subject Headings

EDUCATIONAL LEVEL

High school, Undergraduate lower division

TOPICAL AREAS

History of science, Scientific method

TYPE/METHODS

Teaching Notes & Answer Key

Teaching notes.

Case teaching notes are protected and access to them is limited to paid subscribed instructors. To become a paid subscriber, purchase a subscription here .

Teaching notes are intended to help teachers select and adopt a case. They typically include a summary of the case, teaching objectives, information about the intended audience, details about how the case may be taught, and a list of references and resources.

Download Notes

Answer Keys are protected and access to them is limited to paid subscribed instructors. To become a paid subscriber, purchase a subscription here .

Download Answer Key

Materials & Media

Supplemental materials.

An alternative version of the case is provided below, differing only on p. 5 where figure and text are more historically accurate (but may distract from the overall conclusion).

In addition, we provide a link below to materials available from HHMI BioInteractive that can be used in conjunction with this case.

• Alternative Version

You may also like

Web Seminar

School and district leaders are invited to join us on Thursday, April 11, 2024, from 7:00 PM to 8:00 PM ET, to learn about NSTA’s School and Distric...

Struggling with materials management in your district?  Want to learn tips and tricks from the experts at ECA Science Kit Services? Join us on Th...

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• J Microbiol Biol Educ
• v.15(2); 2014 Dec

Cautionary Tales: Ethics and Case Studies in Science

Ethical concerns are normally avoided in science classrooms in spite of the fact that many of our discoveries impinge directly on personal and societal values. We should not leave the ethical problems for another day, but deal with them using realistic case studies that challenge students at their ethical core. In this article we illustrate how case studies can be used to teach STEM students principles of ethics.

INTRODUCTION

Americans consider morality the most essential part of self ( 11 ).

This may be true of other cultures as well. All societies have elaborate rules of conduct that are often codified into law. Some of these imperatives seem hardwired. Human infants younger than a year and a half will look longer at visual displays showing violations of social rules ( 2 ). It is part of our primate heritage; individuals are punished if they stray far from acceptable behavior. Capuchin monkeys will reject a reward if they think they are being treated unfairly; they have a clear sense of right and wrong which depends on the social situation ( 3 ). Aesop would agree—he penned many a story where animals behaved badly and paid the penalty.

If morality and ethics are so central to our beings, what are our responsibilities as STEM educators to pass along the standards of society? And if we accept this challenge, what is the best way to instruct our youthful comrades in their quest for knowledge? I argue in this article that we should accept this obligation and that case study teaching is an ideal way to deliver the message.

Case-study teaching has a long and honorable lineage ( 4 ). In academic circles we find it used 100 years ago in Harvard Law School. The instructor would bring in a true criminal or civil case that had been adjudicated and conduct a class discussion with future lawyers, asking them to justify the rationale for the final decision—challenging them every step of the way. This provided students a real-world problem as part of their training for a real world ahead. The method was soon adopted by the Harvard Business School and various schools across the country, where it is now the standard. Medical schools have their own version of the method called Problem-Based Learning. Again the idea was to use real world problems to train physicians, but in this case students work in small groups to analyze patient problems and provide diagnoses. The idea of using similar strategies to teach basic sciences to undergraduates is largely due to the efforts of faculty at the University of Delaware and the National Center for Case Study Teaching in Science, where there are hundreds of cases now published http://sciencecases.lib.buffalo.edu/cs/ .

Research has shown that minorities and women undergraduates respond well to cases ( 5 , 8 ). Among this group, cases have been shown to increase students’ understanding of science by encouraging them to make connections between science concepts and situations they may encounter in their lives ( 7 ). In addition, the case method promotes the internalization of learning and the development of analytical and decision-making skills, as well as proficiency in oral communication and teamwork ( 6 ). The method, moreover, is a flexible teaching tool. Cases can take many different forms and be taught in many different ways, ranging from the classical discussion method used in business and law schools, to the arguably strongest approaches, Problem-Based Learning and the Interrupted Case Method, with their emphasis on small-group, cooperative learning strategies ( 4 ).

The method seems ideal for teaching ethics to STEM students. We have plenty of precedents to guide us. We have legal ethics, business ethics, medical ethics, bioethics, geoethics, environmental ethics, teaching ethics, research ethics, engineering ethics, and so on. And, of course, there are religious ethics, with each faith describing canons of behavior not to be breached. Some of them are commonly held community values, such as “thou shalt not steal, lie, or cheat.” Others are more specific, such as the research tenet, “thou should replicate experiments.” While some of these “rules” are so entrenched that they are tantamount to absolutes, others are more fragile and malleable; they are subject to the changing moral landscape. Policies about smoking in public places have rapidly shifted ( 12 ). Decrees against interracial marriage, once laws of the land, are now anachronisms, as are statues against same-sex marriage ( 1 , 10 ). Such shifts in the moral topography offer wonderful opportunities for case studies as they challenge students at their central core of beliefs. There are hundreds of these case studies now available for teachers in repositories such as the National Center for Case Study Teaching in Science ( http://sciencecases.lib.buffalo.edu ), where you can find moral dilemmas depicted in cases on evolution, genetic engineering, nutrition, euthanasia, cloning, and organic farming.

Case studies can be used to show students acceptable standards of behavior within a given profession—the do’s and don’ts—and the disastrous consequences that can occur if the rules are not obeyed. We learn of breaches of research ethics such as fraud, plagiarism, and sloppy book-keeping that ruin careers. We come to know cautionary tales, like Dr. Andrew Wakefield, who misrepresented the medical histories of 12 patients and claimed that his research results showed that vaccinations caused autism. He was eventually discredited and Britain stripped him of his medical license. Unfortunately, this sensational allegation has resulted in thousands of people refusing to have their children vaccinated, with a subsequent striking rise in measles.

In the past, these stories were neglected in the STEM classroom. Questions of right or wrong belonged elsewhere—in the home, in a philosophy class, in a church or tabernacle. In the science classroom we learned how to make petroleum, shoot rockets, synthesize drugs, manipulate DNA, and clone animals, not whether we should do so. Then came the Second World War. The academic community ran squarely into two striking examples of the deep entanglement of science and ethics. Suddenly, there was a public debate about whether Truman’s decision to drop the atom bomb on Japan with the loss of millions of lives was ethical. The sensational trials of generals and scientists implicated in the atrocities at the Nazi concentration camps came to light during the Nuremberg Trials and patient bills of rights were drafted. Today our IRB committees and other ethical bodies monitor our experimental protocols involving research into issues of genetic engineering, stem cell research, three-parent embryos, etc. So my argument is that we should not ignore these disputes in the science classroom; this is where the technology is coming from—the STEM laboratories and the people in charge.

This is especially true as scientists have gained technological expertise; we see more clearly than ever how science and technological decisions can wreak havoc in our lives. Think about science in the courtroom, the public policy decisions on health and insurance, the intrusion of listening devices and the tracking of our e-mails and phone calls, the science of warfare and the use of chemical weapons and drones, the use of chemical fertilizers and organic farming, and possible designer babies. Very little that we humans do is not filled with moral or ethical conundrums. No more should we eschew these quandaries in our classrooms. When we discuss DNA genomes, we should not only speak of how the technology can be used to track potential criminals, but also how it can lead to social and personal dilemmas when we identify parentage, plot evolutionary lineages, discover genetically modified food, and detect mutations that might lead to lethal disease and the loss of insurance. How better to deal with such contentious matters than to use case studies? Case studies are stories with an educational message, and as such they are perfect vehicles to integrate science with societal and policy issues. They are ideal because of their interdisciplinary nature. They deal with real issues that students will face in the future. And people love stories.

RESOURCES FOR ETHICS CASES

There are several STEM case repositories in the world; arguably the largest is the National Center for Case Study Teaching in Science, with over 500 case studies published over the past 25 years. Its greatest strength is in the fields of biology and health-related professions. Over 100 cases are catalogued as having ethical issues, ranging in suitability from middle school student classes to faculty seminars.

We seldom find pure instances of ethical transgressions, where issues of fraud, fabrication, or plagiarism are discussed. Rather, ethical issues are more apt to be a sidebar to the main thrust of a case concentrated on a health or environmental problem. And even in these cases, an individual may not be wrestling with problems involving societal standards. Instead, they grapple with whether it is prudent to make one decision versus another. It may be as simple as whether or not to have an operation or whether it is healthy to use drugs to lose weight.

Let me give you a flavor of the kinds of issues and cases that are available:

Personal dilemma

Often such cases involve medical issues, as we see in “A Right to Her Genes” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=316&id=316 ). In this true story, students examine the case of a woman, Michelle, with a family predisposition to cancer, who is considering genetic testing. The woman wishes to get some information to confirm this predisposition from a reluctant aunt so that she can better decide whether to remove her breasts and/or ovaries prophylactically. The aunt is illiterate and poor and had previously been estranged from the rest of the family. A genetic counselor is involved to help educate the aunt and hopefully obtain consent to get a DNA sample from her. Michelle must decide for herself what course of action she should take.

In “Spirituality and Health Care: A Request for Prayer” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=434&id=434 ), a fourth-year medical student making hospital rounds with an attending physician is asked by a family member of a patient to pray with her. The case allows medical students to explore issues related to patients’ religious beliefs as they think through how they might respond to different expectations and requests they may receive from patients and their families in their professional career.

Social ethics

These are cases where protagonists must decide how they will respond to evolving social standards. “SNPs and Snails and Puppy Dog Tails, and That’s What People Are Made Of” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=337&id=337 ) deals with questions of genome privacy. Students work together to research six lobbying groups’ views in this area and then present their insights before a mock meeting of a U.S. House of Representatives Subcommittee voting on the Genetic Information Nondiscrimination Act. In working through the case, students learn about single nucleotide polymorphisms, common molecular biology techniques, and current legislation governing genome privacy.

“A Case of Cheating?” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=399&id=399 ) involves two international students who are accused of cheating at the end of the semester, and the teacher must decide how to handle the accusation so that all students see that justice is done. The case raises cultural questions in the context of the use of peer evaluation and cooperative learning strategies.

Medical ethics

Patient rights are a common concern in medical cases, whether they are the central issue of the case or a sidebar to teaching students about a particular disease syndrome. It is the central theme of the infamous “Bad Blood” case involving black men in Tuskegee, Alabama, in the 1920s ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=371&id=371 ). They had contracted syphilis, and public health officials studying the progress of the debilitating disease originally did not have an effective treatment. Twenty years later, the antibiotic penicillin was discovered, yet treatment was withheld to maintain the integrity of the study, whose purpose was to follow the progression of the disease. The study was immediately stopped when this transgression was made public.

Often there are competing concerns, as when a person is confronted with a decision where their personal morality may be at odds with the decrees of a society or institution. “The Plan: Ethics and Physician Assisted Suicide” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=436&id=436 ) is based on an article published in 1991 in the New England Journal of Medicine in which Dr. Timothy E. Quill described his care for a patient suffering from acute leukemia, including how he prescribed a lethal dose of barbiturates knowing that the woman intended to commit suicide. As a consequence of the article’s publication, a grand jury was convened to consider a charge of manslaughter against Dr. Quill. Students read the case and then, as part of a classroom-simulated trial, discuss physician-assisted suicide in terms of fundamental medical ethics principles.

Research ethics

Courses in experimental design are frequently part of psychology curricula. They seldom are part of the typical undergraduate programs in other STEM fields, although there is an excellent resource in the text Research Ethics ( 9 ). Apparently, students in STEM disciplines are supposed to absorb the proper canons of behavior by observation and osmosis.

“A Rush to Judgment” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=250&id=250 ) deals with a typical psychological experiment, where a faculty professor is inattentive to his student assistants, one of whom is misrepresenting the results of an experiment. Another student is confronted with a moral dilemma of whether to report this infraction at a potential cost to herself. Involved in the case is a consideration of proper research protocol when dealing with human participants: informed consent, freedom from harm, freedom from coercion, anonymity, and confidentiality. Students are referred to the American Psychological Association's Ethical Principles of Psychologists and Code of Conduct.

“How a Cancer Trial Ended in Betrayal” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=233&id=233 ) begins with a quote from a news item.

Birmingham, Alabama —After Bob Lange spent 8 weeks rubbing an experimental cream, BCX-34, from a prominent biotech company BioCryst on the fiery patches on his body, researchers at the University of Alabama at Birmingham told him the drug was defeating the killer inside him. He felt grateful. “I believed it,” he recalls. “I actually thought I might be cured.” But it was a lie. The drug had no effect on Lange’s rare and potentially fatal skin cancer. And the two key people testing the drug knew it. Lange and 21 other patients were victims of fraud—a scheme made possible by the close tie between the university and the state’s most prominent biotech company. — The Baltimore Sun , June 24, 2001

The authors of this fascinating case state that the learning objectives are to learn the basics of scientific research in a clinical trial; to learn the principles of the scientific method; and to consider the ethical issues involved in clinical trials. Ethical potholes litter the road when universities travel with businesses, and millions of dollars and fame are at stake.

Socio-environmental ethics

Conflicting concerns are the norm when dealing with the environmental problems that beset our world. They not only involve scientific principles, but invariably policy and hurly burly politics as well.

“One Glass for Two People: A Case of Water Use Rights in the Eastern United States” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=603&id=603 ) focuses on the growing issue of water use. Approximately 1.3 million people in North and South Carolina depend on the Catawba-Wateree River for water and electricity. The river is also important for recreation and real estate development. To meet growing water demands, elected officials in Concord and Kannapolis, NC, petitioned their state government to approve an inter-basin transfer of 25 million gallons of water a day from the Catawba River. Other towns in North Carolina and South Carolina that are part of the Catawba-Wateree watershed fought this request for water transfer. For this exercise, students are divided into teams that take the role of different stakeholders trying to negotiate a settlement to this lawsuit. In the course of the debate, students address fundamental legal, ethical, and environmental questions about water use.

“Ecotourism: Who Benefits?” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=359&id=359 ) critically examines the costs and the benefits of visiting fragile, pristine, and relatively undisturbed natural areas. Although ecotourism has among its goals to provide funds for ecological conservation as well as economic benefit and empowerment to local communities, it can result in the exploitation of the natural resources (and communities) it seeks to protect. Students assess ecotourism in Costa Rica by considering the viewpoints of a displaced landowner, banana plantation worker, environmentalist, state official, U.S. trade representative, and national park employee.

Legal ethics

“The Slippery Slope of Litigating Geologic Hazards” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=385&id=385 ) is based on a lawsuit brought against the County of Los Angeles by homeowners suing over damage to their homes in the wake of the Portuguese Bend Landslide. It teaches students principles of landslide movement while illustrating the difficulties involved with litigation resulting from natural hazards. Students first read a newspaper article based on the actual events and then receive details about the geologic setting and landslide characteristics. They are then asked to evaluate the possible causes of the disaster and the responsibilities involved.

“The Sad But True Case of Earl Washington: DNA Analysis and the Criminal Justice System” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=725&id=725 ) recounts how, in 1983, Earl Washington “confessed” to a violent crime that he did not commit and was sentenced to death row. After spending 17 years in prison for something he did not do, Earl was released in 2001 after his innocence was proven through the use of modern DNA technology. The case guides students through the wrongful incarceration of Earl and explores the biological mechanisms behind DNA profiling and the ethical issues involved.

“Complexity in Conservation: The Legal and Ethical Case of a Bird-Eating Cat and its Human Killer” ( http://sciencecases.lib.buffalo.edu/cs/collection/detail.asp?case_id=664&id=664 ) presents the true story of a Texas man who killed a cat that was killing piping plovers, a type of endangered bird species, and was prosecuted for it. In Texas, it is a crime to kill an animal that “belongs to another,” and there was evidence that another person was feeding the cat, which otherwise appeared to be feral. Students engage in a role-playing activity as jurors; they discuss the case and collectively decide whether the cat killer should be acquitted or convicted. This role-playing coupled with follow-up discussions helps students examine and articulate their own views on a controversial environmental issue and gain a better understanding about the complex interdisciplinary nature of conservation science and practice.

There are plenty of ethical issues in every science classroom to discuss; they are not in short supply. They are hovering around every scientific study that reaches the public eye. Pick any news item with science as its theme and there will be the central question that is often not spoken: should we be doing this research at all, not only because of its economic cost, but because of the social, environmental, or health costs? Surely this should be always a pivotal question in the minds of all citizens. It is sometimes asserted that scientific discovery cannot or should not be stopped—that all knowledge is good. But even if we accept that premise, it seems worthwhile to consider the consequences of our actions. Where else to start than in our classrooms?

Acknowledgments

This material is based upon work supported by the National Science Foundation (NSF) under Grant Nos. DUE-0341279, DUE-0618570, DUE-0920264, and DUE-1323355. Any opinions, findings, conclusions, or recommendations expressed in this material are those of the author and do not necessarily reflect the views of the NSF. The author declares that there are no conflicts of interest.